Learn More About Transcreener Method Used for This DDX3 Assay

DDX3 Assay Method

Ordering Information

Assay Services

Related Resources

DDX3 Assay - A Transcreener ADP² Assay Application

Transcreener ADP² Assay directly measures ADP produced by DDX3 (DEAD-box RNA Helicase 3). These ADP measurements allow researchers to effectively determine the activity of the DDX3 enzyme. The assay provides a powerful tool to screen compound libraries for DDX3 modulators to help find new therapies for disease.

The kit comes complete with detection reagents required to measure activity. DDX3 enzyme is not included in the inhibitor screening assay kit. You can purchase DDX3 enzyme from BellBrook Labs separately.

How Does This DDX3 Assay Work?

The Transcreener DDX3 Assay determines DDX3 enzyme activity by directly measuring the ADP formed by the enzyme using the Transcreener ADP Assay. By detecting ADP output, the assay provides a universal method to assess the activity of any ADP-producing enzyme in real-time.

Transcreener DDX3 technology uses a simple but highly effective method that consists of an antibody selective to ADP over ATP and a far-red fluorescent tracer. ADP produced in the reaction competes with the tracer changing the fluorescent properties and providing fluorescent readout.

The DDX3 assay is available with FP, FI, and TR-FRET. It is a simple mix-and-read format. Perform your enzyme reaction, add the detection reagent, and measure. The simplicity of the system yields robust results that also makes it extremely amiable to HTS.

Direct Detection of ADP to Measure DDX3 Enzymatic Activity

Fluorescent Polarization (FP)

The workhorse. Used in many large screens. Best deck and signal stability.

Learn More About The FP Assay

Transcreener ADP FP Assay Tech Manual

Fluorescent Intensity (FI)

Positive FI signal. Compatible with simple fluorescence plate readers. Faster read time than FP or TR-FRET.

Learn More About The FI Assay

Transcreener ADP FI Assay Tech Manual

Time-Resolved Förster Resonance Energy Transfer (TR-FRET)

For customers who prefer TR-FRET detection. Uses the same filter set as HTRF^®.

Learn More About the TR-FRET Assay

Transcreener ADP TR-FRET Assay Tech Manual

Applications

Measure Enzymatic Activity of DDX3
Screen Compound Libraries for DDX3 Modulators
Quantify Inhibitor Potency
Inhibitor Selectivity Profiling
Measure Drug-Target Residence Time

Features

Direct detection of unlabeled ADP
Easy to use, homogenous, one-step format
Robust Assay Z’ > 0.7 under initial velocity conditions
Far-red fluorescent readouts minimize compound interference
A safe, non-radioactive method
Available in FP, FI, or TR-FRET readouts

Easy-to-Use, Mix-and-Read, HTS-Ready Assay

Run your enzyme reaction, add Transcreener reagents, and read your plates. The DDX3 assay is compatible with 96, 384, and 1536-well formats.

Back To Top

Robust Assay Yields Quality Data

Z’ measurements using optimized DDX3 reaction conditions indicate a robust assay. Robust data like this is vital for sizeable high throughput screens that are difficult to complete due to massive sample quantity. Z' shown here = 0.73.

Detection of ADP Under DDX3 Initial Velocity - FP Readout

The assay demonstrates linearity when raw data is converted to ADP using a standard curve. Here we use 500 µM ATP with 5 µM dsRNA substrate. Linearity is shown here under initial velocity conditions when raw data is converted to ADP formed. The buffer includes 25 mM Tris pH 7.5, 1 mM MgCl₂ 0.005% Brij, 225 μg/mL ADP² antibody, and 2 nM ADP Alexa 633 tracer. The DDX3 enzyme reaction took place for 60 minutes at 37ºC in kinetic mode.

Human DDX3 Enzyme Titration

Linear Response

Screen for Inhibitors & Perform SAR

Transcreener Assays are designed for screening compound libraries in a high throughput format. Follow-up SAR can also be performed using the assay to determine inhibitor potency with ease. Assay conditions include 15 nM DDX3 (BellBrook Labs), 500 µM ATP, and 5 µM dsRNA for 60 minutes at 37ºC in kinetic mode.

Dose-Response - Suramin

IC₅₀ = 0.092 µM

BellBrook Lab's Recombinant DDX3 Enzyme

Active, DEAD-box RNA helicase DDX3 enzyme (aa135-583), His-tagged protein expressed and purified from E.coli. The enzyme has been thoroughly validated with Transcreener ADP² Activity Assays. For specific activity, please refer to the Certificate of Analysis for each individual enzyme lot. Purity is >90% in a 50 mM Tris-HCl pH 8.0, 150 mM NaCl, and 10% glycerol buffer composition. Currently used with the Transcreener assay at a concentration between 15 and 30 nM.

Go to DDX3 Enzyme Page

DDX3 Assay Services

Interested in moving your program forward, but don't want to bring an assay in-house? Our scientists can help! BellBrook scientists will use their extensive biochemistry and enzymology expertise to work with you and accelerate your DDX3 program.

Lead Discovery Services Include:

Inhibitor Screening – To identify or confirm activity with the target.
Inhibitor Potency Profiling – Dose-response with target and/or related proteins. Fast IC₅₀ results.
Residence Time Measurements – Determination of k_off using ‘jump dilution’ enzymatic assay method.
Mechanism of Action Studies – Kinetic analysis to define the mode of inhibition.

Contact Us to Learn More

Please fill out the form below. We will respond quickly to get the conversation moving and learn how we can help. We keep things discrete, confidential, and professional.

Back To Top

Far-Red FP, FI & TR-FRET Readouts Validated on Major Multimode Readers

Instrument	FP Assays	FI Assays	TR-FRET Assays
TriStar²S LB 942	in review	validated	validated
Mithras² LB 943	in review	validated	validated

Cytation™ 5	validated	validated	validated
Cytation™ 3	validated	validated	validated
Cytation™ 1	validated	validated	validated
Synergy™ H1	validated	validated	validated
Synergy™ 2/H4/4	validated	validated	validated
Synergy™ HTX	not capable	validated	not capable
Synergy™ Neo 2	validated	validated	validated

POLARstar^® Omega	validated	validated	validated
FLUOstar^® Omega	not capable	validated	validated
PHERAstar^® FSX	validated	validated	validated
PHERAstar^® Plus/FS	validated	validated	validated
CLARIOstar^® /Plus	validated	validated	validated
VANTAstar^™	validated	validated	validated

Sense	in review	validated	in review

Analyst^® GT/HT	validated	validated	validated
Gemini^® XPS/EM	not capable	validated	not capable
SpectraMax^® M2/M2e	not capable	validated	not capable
SpectraMax^® M5/M5e/FlexStation^® 3	not capable	validated	validated
SpectraMax^® Paradigm	validated	contact us	contact us
SpectraMax^® iD3/iD5	in review	validated	validated

EnVision^®/EnVision^® Xcite	validated	validated	validated

Infinite^® M1000/M1000Pro/Safire2™	validated	validated	validated
Infinite^® M200	not capable	validated	not capable
Infinite^® F500	validated	validated	validated
Infinite^® F200/Ultra^evolution	contact us	validated	contact us
Spark™ 10M	validated	validated	validated

What's Included


Component	Notes
ADP² Antibody	Antibody specific to the nucleotide ADP. Suggested ADP² antibody concentration (in the Detection Mixture) for FP is 225 μg/mL for 500 μM ATP. Yours may vary depending on, enzyme, and buffer composition.
ADP Tracer	When displaced, changes in fluorescence can be read in an FP, FI, or TR-FRET depending on the assay format.
ATP and ADP	ATP and ADP are used to create the ATP/ADP standard curve. ATP is used as a phosphate donor to start the reaction. We suggest using a starting ATP concentration of 500 μM for DDX3.

What You Will Need


Component	Notes
DDX3 Enzyme	We have successfully used recombinant human DDX3 produced internally. Enzyme is available through BellBrook Labs. A DDX3 concentration of between 15 nM and 30 nM was used for screening and SAR.
Enzyme Buffer	25 mM Tris (pH 7.5), 1 mM MgCl_2,, 0.005% Brij-35. Enzyme buffer components may be optimized as required.
dsRNA Substrate	Here we used 28 bp 5'-3' dsRNA at 5 μM. dsRNA with 3'overhang - sequence: CAUUAUCGGAUAGUGGAACCUAGCUUCGACUAUCGGAUAAUC GCUAGGUUCCACUAUCCGAUAAUG
Assay Plates	Assay Plates Can Be Purchased Directly Through BellBrook Labs FP - An entirely black plate with a non-binding surface is required. We suggest Corning 384-well plates Cat. #4514 FI - An entirely black plate with a non-binding surface is required. We suggest Corning 384-well plates Cat. #4514 TR-FRET - An entirely white plate with a non-binding surface is required. We suggest Corning 384-well plates Cat. #4513
Plate Reader	A multi-detection microplate reader configured to measure the output of the ADP tracer is required.
Liquid Handling Devices	Use liquid handling devices that can accurately dispense sub-microliter volumes into 384-well plates.
Ultrapure Water	Some deionized water systems are contaminated with nucleases that can degrade both nucleotide substrates and products, reducing assay performance. Careful handling and use of ultrapure water eliminates this potential problem.

Back To Top

Transcreener ADP² Assay Kits - For DDX3 Activity Assays

* For custom or bulk orders (over 100,000 wells) please contact us (info@bellbrooklabs.com) for a quote.


Cat. No.	Product Description	Price	Add to Cart
3013-A	Transcreener ADP² FI Assay (200 Assay, 96 Well)	$329.00	Add to Cart
3013-1K	Transcreener ADP² FI Assay (1,000 Assay, 384 Well)	$689.00	Add to Cart
3013-10K	Transcreener ADP² FI Assay (10,000 Assay, 384 Well)	$3,989.00	Add to Cart
3013-100K	Transcreener ADP² FI Assay (10 X 10,000 Assay, 384 Well)	$19,945.00	Add to Cart
3010-1K	Transcreener ADP² FP Assay (1,000 Assay, 384 Well)	$659.00	Add to Cart
3010-10K	Transcreener ADP² FP Assay (10,000 Assay, 384 Well)	$3,789.00	Add to Cart
3010-100K	Transcreener ADP² FP Assay (10 X 10,000 Assay, 384 Well)	$18,945.00	Add to Cart
3011-1K	Transcreener ADP² TR-FRET Red Assay (1,000 Assay, 384 Well)	$719.00	Add to Cart
3011-10K	Transcreener ADP² TR-FRET Red Assay (10,000 Assay, 384 Well)	$4,109.00	Add to Cart
3011-100K	Transcreener ADP² TR-FRET Red Assay (10 X 10,000 Assay, 384 Well)	$20,545.00	Add to Cart

DDX3 Enzyme Ordering Information

* For custom or bulk orders (over 1,000 µg) please contact us (info@bellbrooklabs.com) for a quote.


Cat. No.	Product Description	Price	Add to Cart
2251	Recombinant DDX3 Enzyme, Active, Human, 10 µg	$399.00	Add to Cart
2252	Recombinant DDX3 Enzyme, Active, Human, 100 µg	$1,399.00	Add to Cart
2253	Recombinant DDX3 Enzyme, Active, Human, 1,000 µg	$4,899.00	Add to Cart

Assay Plates for FI & FP

Edit
Cat. No.	Product Description	Price
2233	Corning 96-Well Black Assay Plates (#3686), 3-Pack (200+ Assays)	$40.00	Add to Cart
2229	Corning 384-Well Black Assay Plates (#4514), 3-Pack (1,000+ Assays)	$45.00	Add to Cart
2230	Corning 384-Well Black Assay Plates (#4514), 30-Pack (10,000+ Assays)	$400.00	Add to Cart

Assay Plates for TR-FRET

Cat. No.	Product Description	Price
2234	Corning 96-Well White Assay Plates (#3642), 3-Pack (200+ Assays)	$50.00	Add to Cart
2231	Corning 384-Well White Assay Plates (#4513), 3-Pack (1,000+ Assays)	$60.00	Add to Cart
2232	Corning 384-Well White Assay Plates (#4513), 30-Pack (10,000+ Assays)	$499.00	Add to Cart

Back To Top

The Role of DDX3 As a Therapeutic Target

DDX3 is a DEAD-box group protein (RNA helicase family). It is involved in several cellular activities, including innate immunity, viral reproduction, and tumorgenesis (Kukhanova, 2020). DDX3 unwinds various forms of dsRNA, both 5' - 3' and 3' - 5'. It requires ATP and Mg²⁺ to unwind and releases RNA via ATP hydrolysis.

In some viruses such as HIV, DDX3 enables viral replication, while in others (such as Dengue), it has an anti-viral effect. The RNA helicase has similar effects on some cancer studies, wherein one type DDX3 is a tumor suppressor, while in another it acts as an enhancer. These qualities make DDX3 an interesting target for treating a variety of diseases.

The Transcreener ADP² DDX3 Assay is an excellent tool for researchers examining the therapeutic effects of DDX3.

DDX3 Assay – Transcreener Application

Learn More About Transcreener Method Used for This DDX3 Assay

DDX3 Assay Method

Ordering Information

Assay Services

Related Resources

DDX3 Assay - A Transcreener ADP2 Assay Application

How Does This DDX3 Assay Work?

Direct Detection of ADP to Measure DDX3 Enzymatic Activity

Fluorescent Polarization (FP)

Fluorescent Intensity (FI)

Time-Resolved Förster Resonance Energy Transfer (TR-FRET)

Applications

Features

Easy-to-Use, Mix-and-Read, HTS-Ready Assay

Robust Assay Yields Quality Data

Detection of ADP Under DDX3 Initial Velocity - FP Readout

Human DDX3 Enzyme Titration

Linear Response

Screen for Inhibitors & Perform SAR

Dose-Response - Suramin

IC50 = 0.092 µM

BellBrook Lab's Recombinant DDX3 Enzyme

DDX3 Assay Services

Lead Discovery Services Include:

Contact Us to Learn More

Far-Red FP, FI & TR-FRET Readouts Validated on Major Multimode Readers

What's Included

What You Will Need

Transcreener ADP2 Assay Kits - For DDX3 Activity Assays

DDX3 Enzyme Ordering Information

Assay Plates for FI & FP

Assay Plates for TR-FRET

The Role of DDX3 As a Therapeutic Target

Related Resources

DDX3 Assay - A Transcreener ADP² Assay Application

IC₅₀ = 0.092 µM

Transcreener ADP² Assay Kits - For DDX3 Activity Assays