Application Note: Detection of WRN Exonuclease Activity with the Transcreener dAMP Assay

Ordering Information

WRN Exonuclease Assay Services

Related Resources

WRN Exonuclease Assay - A Transcreener dAMP Assay Application

The WRN Exonuclease Assay uses the Transcreener^® dAMP Assay to directly measure dAMP produced during the degradation of DNA. It is a far-red, competitive assay designed for high-throughput screening (HTS), with a single-addition, mix-and-read format. The assay is an excellent tool for researchers screening compound libraries to discover WRN modulators.

The kit comes complete with the detection reagents required to measure activity. WRN exonuclease is not included in the inhibitor screening assay kit. Please contact us for questions related to acquiring the enzyme. This assay is designed to be used with purified enzyme preparations. Transcreener assays are not validated with cell lysates, blood, serum, or other biological samples.

An Overview of the WRN Exonuclease Assay Method

The Transcreener WRN Exonuclease Assay determines enzyme activity by directly measuring dAMP formed by the enzyme using the Transcreener dAMP Exonuclease Assay. This biochemical HTS assay provides a universal method to assess the activity of virtually any exonuclease that produces dAMP.

Transcreener dAMP technology uses polyclonal mouse antibodies that selectively bind to dAMP and a far-red fluorescent tracer. dAMP produced displaces the tracer, changing the fluorescent properties and providing a fluorescent readout.

The WRN exonuclease assay is an easy-to-use, mix-&-read, HTS-ready assay that yields robust results. All you need to do is perform the enzyme reaction, add Transcreener reagents, and read your plates. It is available with an FP fluorescent readout.

Directly Detect dAMP to Measure WRN Exonuclease Activity with an FP Readout

Transcreener WRN Exonuclease Assay Schematic

Learn More About The dAMP Assay

Transcreener dAMP FP Assay Tech Manual

Applications

Measure Enzymatic Activity of WRN Exonuclease
Screen Compound Libraries for WRN Exonuclease Modulators
Quantify Inhibitor Potency
Inhibitor Selectivity Profiling

Features

Direct detection of unlabeled dAMP
Easy to use, homogenous, one-step format
Robust Assay Z’ > 0.7 under initial velocity conditions
Far-red fluorescent readouts minimize compound interference
A safe, non-radioactive method
Available in a robust FP fluorescent readout

Easy-to-Use, Mix-and-Read, HTS-Ready Assay

Run your enzyme reaction, add Transcreener reagents, and read your plates. The WRN exonuclease assay is compatible with 96, 384, and 1536-well formats.

Robust Assay Yields Quality Data

Z’ measurements using optimized reaction conditions indicate a robust assay. Robust data like this is vital for sizeable high throughput screens that are difficult to complete due to massive sample quantity. Z' shown here = 0.89.

Detection of dAMP Under WRN Exonuclease Initial Velocity Conditions

The assay demonstrates linearity when raw data is converted to dAMP using a standard curve. We used 2 μM Annealed DNA substrate and a titration starting at 50 nM WRN Exonuclease. The enzyme buffer included 50 mM HEPES (pH 7.5), 5 mM MnCl₂, 5 mM MgCl₂, and 1 mM DTT. The Detection Mix included 28 μg/mL dAMP antibody, 4 nM dAMP Alexa Fluor 633 tracer, and 1X Stop & Detect Buffer B in 10 μL. The WRN Exonuclease enzyme reaction took place for 60 minutes at room temperature. The Detection Mix was added and incubated for 90 minutes and read with a CLARIOstar plate reader.

WRN Exonuclease Enzyme Titration

Enzyme Titration with WRN Exonuclease Assay

Linear Response

Screen for Inhibitors & Perform SAR

Transcreener Assays are designed for screening compound libraries in a high throughput format. Follow-up SAR can also be performed using the assay to determine inhibitor potency with ease. Assay conditions include 1 nM WRN exonuclease, 50 mM HEPES (pH 7.5), 5 mM MnCl₂, 5 mM MgCl₂, 1 mM DTT, and 1 μM Annealed DNA. The Detection Mix consists of 1X Stop & Detect Buffer B, 28 μg/mL dAMP Ab, and 4 nM dAMP tracer.

Dose-Response - Suramin

WRN Exonuclease Assay Dose Response Curve with Suramin

IC₅₀ = 0.11 µM

Back To Top

WRN Exonuclease Assay Services

BellBrook Labs offers WRN exonuclease assay services using our trusted Transcreener dAMP Assay. BellBrook scientists will use their extensive biochemical and enzymology expertise to work with you and accelerate your exonuclease program. We tailor our efforts to meet your specific needs, saving you both time and money. Accelerate your WRN exonuclease program with our drug discovery services.

Drug Discovery Services Include:

Inhibitor Screening - To identify or confirm activity with the target.
Inhibitor Potency Profiling - Dose-response with target and/or related proteins. Fast IC₅₀ results.
Residence Time Measurements - Determination of k_off using 'jump dilution' enzymatic assay method.
Mechanism of Action Studies - Kinetic analysis to define the mode of inhibition.
Triaging Non-stoichiometric Inhibitors - Run assays under different conditions, such as varying detergent and enzyme concentrations.

Contact Us to Learn More

Please fill out the form below. We will respond quickly to get the conversation moving and learn how we can help. We keep things discrete, confidential, and professional.

Back To Top

Far-Red FP Readouts Validated on Major Multimode Readers

Supplier	Instrument	FP Assays
	TriStar²S LB 942	In Review
	Tristar 5	In Review
	Mithras² LB 943	In Review

	Cytation^TM 5	Validated
	Cytation^TM 3	Validated
	Cytation^TM 1	Validated
	Synergy^TM H1	Validated
	Synergy^TM 2/H4/4	Validated
	Synergy^TM HTX	Not Capable
	Synergy^TM Neo 2	Validated

	POLARstar^® Omega	Validated
	FLUOstar^® Omega	Not Capable
	PHERAstar^® FSX	Validated
	PHERAstar^® Plus/FS	Validated
	CLARIOstar^® /Plus	Validated
	VANTAstar^TM	Validated

	Sense	In Review

	Analyst^® GT/HT	Validated
	Gemini^® XPS/EM	Not Capable
	SpectraMax^® M2/M2e	Not Capable
	SpectraMax^® M5/M5e/FlexStation^® 3	Not Capable
	SpectraMax^® Paradigm	Validated
	SpectraMax^® iD3/iD5	Validated
	SpectraMax^® i3x	Validated

	EnVision^®/EnVision^® Xcite	Validated

	Infinite^® M1000/M1000Pro/Safire2^TM	Validated
	Infinite^® M200	Not Capable
	Infinite^® F500	Validated
	Infinite^® F200/Ultra^evolution	Contact Us
	Spark^TM 10M	Validated

What's Included


Component	Notes
dAMP Antibody	Antibody specific to the nucleotide dAMP. Suggested dAMP antibody concentration for 2 µM Annealed DNA substrate (in the Detection Mixture) is 28 μg/mL. Yours may vary depending on enzyme, and buffer composition.
dAMP Tracer	When displaced, changes in fluorescence can be read in an FP assay format. The suggested concentration for 2 μM Annealed DNA substrate (in the Detection Mixture) is 4 nM tracer.
Stop & Detect Buffer B, 10X	To ensure that the enzyme reaction is stopped completely, confirm that the EDTA concentration is at least equimolar to the Mg²⁺ concentration in the reaction. The final concentration of Stop & Detect Buffer B at the time of FP measurement is 0.5X.
dAMP	The dAMP in this kit can be used to generate a standard curve which can be used to convert mP values to dAMP product formed.

What You Will Need


Component	Notes
WRN Exonuclease Enzyme	We used recombinant human WRN exonuclease produced in-house. A concentration of 1 nM in reaction was used for screening and SAR.
Enzyme Buffer	50 mM HEPES (pH 7.5), 5 mM MnCl₂, 5 mM MgCl₂, and 1 mM DTT. Enzyme buffer components may be optimized as required.
Substrate	Here, we use 2 µM 53-bp annealed duplexed DNA oligomer Annealed duplex with 5' overhangs - sequence: Sense: 5' - GCGCGGAAGCTTGTTTGTTTATTCGCTGTCTTGTGGAAATCGAAAATAGACTA - 3' Anti-sense: 5' - GGCTAGCCGAAGGTAGTCTATTTTCGATTTCCACAAGACAGCGAATAAACAAA - 3'
Assay Plates	Assay Plates Can Be Purchased Directly Through BellBrook Labs FP - An entirely black plate with a non-binding surface is required. We suggest Corning 384-well plates Cat. #4514
Plate Reader	A multi-detection plate reader configured to measure the output of the dAMP tracer is required.
Liquid Handling Devices	Use liquid handling devices that can accurately dispense sub-microliter volumes into 384-well plates.
Ultrapure Water	Some deionized water systems are contaminated with nucleases that can degrade both nucleotide substrates and products, reducing assay performance. Careful handling and use of ultrapure water eliminates this potential problem.

Back To Top

Transcreener dAMP Assay Kits - For WRN Exonuclease Activity Assays

* For custom or bulk orders (over 100,000 wells) please contact us (info@bellbrooklabs.com) for a quote.

Cat. No.	Product Description	Price	Add to Cart
3028-1K	Transcreener dAMP Exonuclease FP Assay (1,000 Assay, 384 Well)	$725.00	Add to Cart
3028-10K	Transcreener dAMP Exonuclease FP Assay (10,000 Assay, 384 Well)	$4,199.00	Add to Cart
3028-100K	Transcreener dAMP Exonuclease FP Assay (10 X 10,000 Assay, 384 Well)	$20,995.00	Add to Cart

Assay Plates for FP

Cat. No.	Product Description	Price	Add to Cart
2233	Corning 96-Well Black Assay Plates (#3686), 3-Pack (200+ Assays)	$55.00	Add to Cart
2229	Corning 384-Well Black Assay Plates (#4514), 3-Pack (1,000+ Assays)	$60.00	Add to Cart
2230	Corning 384-Well Black Assay Plates (#4514), 30-Pack (10,000+ Assays)	$479.00	Add to Cart

Back To Top

Related Resources

Interconnections Between the DNA Damage Response and Innate Immunity

There is extensive crosstalk between the DNA damage response (DDR) pathways and innate immune pathways. Both the individual pathways and the interconnections between them are a focus for exciting new small molecule drug therapeutics that target cancers and debilitating autoimmune disorders. The Transcreener HTS Assay platform accelerates these efforts by providing a robust and easy-to-use biochemical assay to measure activity of key enzymes in the innate immune and DDR pathway.

In this guide, we provide an overview of the DDR and innate immune pathway, and describe Transcreener Assays and Assay Systems for key therapeutic targets. The enzyme targets discussed include:

DDR

POLQ
WRN
PARP1
PARG
DNA PK

Innate Immunity

cGAS
TREX1
TBK1
IKKβ
IRAK4
ENPP1

CD38
OAS-1
RIG-1/MDA5
DDX3
CD39
CD73

DNA Damage Response and Innate Immunity Preview

WRN As a Therapeutic Target

WRN is one of the 5 evolutionarily conserved RecQ helicases found in humans. All human RecQ helicases hydrolyze ATP, unwind double stranded DNA, and are proficient at repairing DNA breaks. WRN alone possesses an exonuclease function. The helicase and exonuclease domains can act alone or in concert to address a variety of DNA substrates, such as double stranded DNA breaks, DNA duplexes, replication forks, Holliday junctions, and G-quadruplexes.

Deficient or impaired production of WRN produces accelerated senescence and a greatly increased risk of cancer. The WRN exonuclease assay accelerates and simplifies the process to discover WRN modulators.

Read more about WRN in this article from BellBrook labs: Can WRN Helicase Inhibitors Treat MSI-H Cancers?

WRN Exonuclease Assay – Transcreener Application

Application Note: Detection of WRN Exonuclease Activity with the Transcreener dAMP Assay

Ordering Information

WRN Exonuclease Assay Services

Related Resources

WRN Exonuclease Assay - A Transcreener dAMP Assay Application

An Overview of the WRN Exonuclease Assay Method

Directly Detect dAMP to Measure WRN Exonuclease Activity with an FP Readout

Applications

Features

Easy-to-Use, Mix-and-Read, HTS-Ready Assay

Robust Assay Yields Quality Data

Detection of dAMP Under WRN Exonuclease Initial Velocity Conditions

WRN Exonuclease Enzyme Titration

Linear Response

Screen for Inhibitors & Perform SAR

Dose-Response - Suramin

IC50 = 0.11 µM

WRN Exonuclease Assay Services

Drug Discovery Services Include:

Contact Us to Learn More

Far-Red FP Readouts Validated on Major Multimode Readers

What's Included

What You Will Need

Transcreener dAMP Assay Kits - For WRN Exonuclease Activity Assays

Assay Plates for FP

Related Resources

Interconnections Between the DNA Damage Response and Innate Immunity

DDR

Innate Immunity

WRN As a Therapeutic Target

Related Resources

IC₅₀ = 0.11 µM